Assignment of porcine serotonin receptor subtype 2 alpha and endothelin-B receptor to chromosome 11 by linkage analysis.

Genus and Species. Sus scrofa. Locus. Pig serotonin receptor subtype 2 alpha ( HTR2A) and pig endothelin-B receptor ( EDNRB) . Source and Description of Primers. Heterologous primers for EDNRB were obtained from Leslie Lyons through the CATS project (Lyons et al., 1997) and primers for HTR2A were designed from highly conserved human (M86841) and mouse sequences (X72222). Primers ( EDNRB forward: 5¢AATTGTTTTAATTTGGGTGGTCTC3¢ and EDNRB reverse: 5¢-AGCCACCAGTCTTTAGCTGTC-3¢; HTR2A forward: 5¢-CCCTAGAGAAAAAGCTGCAGA-3¢ and HTR2A reverse: 5¢GACACGGGCATGACAAGGA-3¢) were used to amplify pig homologous fragments by standard PCR. Pig genomic fragments amplified with heterologous primers were sequenced to confirm homology. An 81% similarity over 125 bp was found in the exon 3 region of the EDNRB gene between human and the new pig sequence-tagged sites ( STS) . A 100% sequence similarity was found for 115 bases of the exon 1 region of HTR2A gene between our STS and a pig HTR2A cDNA sequence (accession no. S78208). Pig-specific primers were designed from the pig STS obtained in this study ( HTR2A forward: 5¢CCCTAGAGAAAAAGCTG CAGA-3¢ and HTR2A reverse: 5¢-GCAGAGGCCACCGGTA-3¢) to increase the PCR efficiency.